Coronavirus COVID-19 - Global Health Pandemic #43

[tresir2012]

Iirc Dr. Fauci thinks immunity will be short lived, like immunity to a common cold. Might be in the Town Hall link upthread. Moo
@gregjrichards just noticed your post!
(Auto correct always misspells Dr. Fauci’s name.)

What about pregnant women like Carrie Symons, Boris Johnsons partner who has stated she has it too. Will her baby be born immune?

 

[CoverMeCagney]

View attachment 241787 View attachment 241788

Designers say testing shows that layering two blue shop towels inside cotton face masks could help increase effectiveness of homemade PPEs

Their testing indicated that ToolBox and Zep shop towels had higher levels of filtration than other blue shop towels

Designers say layers blue shop towels inside cotton masks could help effectiveness of homemade PPEs | Daily Mail Online

**There will be a White House press conference on the coronavirus at 3:30pm ET on CNN**

Those paper towels cured EVERYTHING in primary school - bruises, cuts, grazes, fractured limbs - just put a wet paper towel on it!

 

[MimosaMornings]

My point is how many people that received no test but were told over the phone they are more than likely positive follow orders? After working with a certain population, I’d say few. I’ll say it again, I’d prefer to walk the streets of NYC than my own. I bet all hell breaks out here after this weekend. My landscaper is mowing, I spoke with him thru the glass storm door, he also commented on the bumper to bumper traffic. Hard to imagine where people are going.....

Good grief @Trudie
Where in the heck is everyone going?

I was on a major interstate 3 weeks ago on a weekend and there was hardly any traffic.
And I was on it for hours. It is usually bumper to bumper on a weekend.
Mostly tractor trailers.

 

[margarita25]

Could you link one of these articles from a scientific journal? TIA.

Hi tresir2012:

This is an important report re: China that I haven’t gotten through yet, but it’s on the list of very important reports imo:

Report of the WHO-China Joint Mission on Coronavirus Disease 2019 (COVID-19)
16-24 February 2020

https://www.who.int/docs/default-so...na-joint-mission-on-covid-19-final-report.pdf

 

[tresir2012]

The only way to completely eradicate a virus like CoVid19 is to eliminate all human carriers. That's not going to happen.

This virus is here to stay, just like the flu, small pox, etc. Small pox is unfortunately not entirely eradicated (they recently found it in soil that is defrosting as the planet warms up - so small pox vaccination may be a thing that some of you see within your lifetime).

We can only hope to get it to be at very low rates while we develop a vaccine. Since now we have fairly large numbers of anti-vaxxers, CoVid19 will likely always have a home. It's super important that the vaccine be effective in older populations if we wish to keep current life expectancy where it is. Next year, we'll see some changes in global LE (obviously, it will go down).

I do think that within a year or two there will be major breakthroughs in viable treatments that work for people who very ill with CV. The fact that no one can tell (without a test) whether they have one of many flus, common colds - or CoVid19 - will remain a problem.

I keep thinking about this. For the rest of my life, this virus is out there. Even if we all make it through this crisis of herd immunity, if it's like other CoVid viruses, many of us will lose our initial immunity, if we ever get it, after 2-3 years. A vaccine is a necessity. I'm glad to hear from scientists that they are optimistic, but until we actually get such a vaccine, it's a gloomy picture for older people.

All the travel plans my DH and I had for our golden years are on hold, indefinitely, perhaps forever.

Years ago, I was told if blankets from a smallpox patient were put in a chest and left for 100 years then opened, you could still contract smallpox from those blankets. If they get a vaccine for CV19, I wonder if they will just add it to the annual flu vaccine?

 

[Trudie]

@musicaljoke here is an example. Now, since WMT is the major store in a rural, small town, I think he should have stated the patient worked at the deli bakery & anyone that shopped on blah blah dates might want to speak with their doctor or at least pay attention to symptoms. Moo. We did not need an epidemiologist to advise on her place of employment. Jmo.

Kentucky Has First Confirmed Case Of COVID-19 From Coronavirus

Beshear said the patient is in Lexington and is being treated in isolation at a hospital. He declined to provide other details, saying more information would be shared once epidemiologists learned more.

 

[gngr~snap]

Coronavirus: Shelter in place for another 5 months? Here's what Stanford researchers are projecting and why

 

[margarita25]

So, one of my best friends in the world, her husband is experiencing symptoms. We are waiting for test results. No idea when they’ll come back. Its already been a few days. Sweating bullets because they are both in their 70s and her husband has significant underlying issues.

This is the world we live in now.

 

[mickey2942]

"Babe, I got you, Babe". My husband just started crooning this to me. We did a duet for a few minutes. We must be going batty.

I wonder what will happen in the next few weeks. Things have changed so fast in the last month. I would like my Mom to come here, and my husband wonders if in another month, if she will even be able to get here. Who knows?

 

[Gardenista]

Multiple coronavirus patients are accidentally transferred to New York City hospital ship - which is meant to be 'virus-free' and only used for trauma patients

 

[Trudie]

Camping, boating? WMT? Looking for TP? Idk
I think it was anticipated to be a large weekend filled with outings, in KY. It was addressed at the last PC and we were asked to stay home. I linked earlier, people resorted to calling state police to question the directives. Lol 3 weeks sounds like a lifetime ago, huh? I bet if you went for a drive today you’d see a lot of traffic. Again, it isn’t isolated to one area, imo.

Good grief @Trudie
Where in the heck is everyone going?

I was on a major interstate 3 weeks ago on a weekend and there was hardly any traffic.
And I was on it for hours. It is usually bumper to bumper on a weekend.
Mostly tractor trailers.

 

[RANCH]

I went to the Food4Less to get some groceries this morning. No lines to get in and not very crowed inside the store.

Used the single 3M N100 respirator that I have. Most people did not have any mask on at all. Store shelves where almost back to normal with no limit on water. Zero toilet paper and limited paper towel still. Spam was almost gone but other than those items they was plenty for everyone.

Checkout has plexiglass barrier now. Got some turkey legs that I will brine and grill for dinner.

That's my shopping report from Sacramento California.

 

[margarita25]

Coronavirus: Shelter in place for another 5 months? Here's what Stanford researchers are projecting and why

Thank you for this article. I’ve been meaning to check in on Santa Clara County.

@MJPeony how are you?

From the above link / BBM;

"”We estimate that shelter-in-place would have to remain in place for about five months or more in order to actually completely suppress the epidemic," said Stanford biology professor Erin Mordecai.

While it's not likely for a shelter-in-place order to remain in effect for that long, Mordecai says we're beginning to see some of the positive effects of social distancing in Santa Clara County, based on data from the global MIDAS network. However, lifting interventions too early could lead to a second outbreak. With that said, strategies such as more widespread testing could lead to better contact tracing.

"That would allow us to concentrate the intervention on just the people that are infectious at any given time, and allow other people to maybe not fully go about their normal lives, but at least be able to get a little more social contact and get back out into the world a little more," said Mordecai.”

Coronavirus: Shelter in place for another 5 months? Here's what Stanford researchers are projecting and why

• As I stated earlier, a “second wave” / additional waves is a huge concern of mine right now. But we have to get through the first wave. This is all so overwhelming to put it mildly.

Yeah, my mind is already thinking about the second wave.

We are going to need to handle transitioning and resuming back to “regular life”, releasing restrictions with kid gloves imo or we’ll be here who knows how long.

We have to be very careful not to rush this process and decisions, but it’s going to be hard due to a variety of reasons, namely economic pressure and impatience.

Jmo

 

[dotr]

Huge article..
April 3 2020
Bad News Wrapped in Protein: Inside the Coronavirus Genome
''A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.

In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.

Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.

A String of RNA
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

The first sequence of RNA letters reads:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins.''

 

[Trudie]

Denton County child advocates worry abuse may go unnoticed, unreported amid COVID-19 restrictions
Denton County child advocates worry abuse may go unnoticed, unreported amid COVID-19 restrictions


So sad to think how many kids are being abused during this.

 

[Sillybilly]

Gee dotr, for a minute there I thought a cat sat on your keyboard.

 

[bluedivergirl]

Where would I find such a wonder as a shop towel? I can't even find regular paper towels.

Automotive repair shop. I've seen them at Sam's Club, if you're brave enough to go there.

 

[Herat]

The only way to completely eradicate a virus like CoVid19 is to eliminate all human carriers. That's not going to happen.

This virus is here to stay, just like the flu, small pox, etc. Small pox is unfortunately not entirely eradicated (they recently found it in soil that is defrosting as the planet warms up - so small pox vaccination may be a thing that some of you see within your lifetime).

We can only hope to get it to be at very low rates while we develop a vaccine. Since now we have fairly large numbers of anti-vaxxers, CoVid19 will likely always have a home. It's super important that the vaccine be effective in older populations if we wish to keep current life expectancy where it is. Next year, we'll see some changes in global LE (obviously, it will go down).

I do think that within a year or two there will be major breakthroughs in viable treatments that work for people who very ill with CV. The fact that no one can tell (without a test) whether they have one of many flus, common colds - or CoVid19 - will remain a problem.

I keep thinking about this. For the rest of my life, this virus is out there. Even if we all make it through this crisis of herd immunity, if it's like other CoVid viruses, many of us will lose our initial immunity, if we ever get it, after 2-3 years. A vaccine is a necessity. I'm glad to hear from scientists that they are optimistic, but until we actually get such a vaccine, it's a gloomy picture for older people.

All the travel plans my DH and I had for our golden years are on hold, indefinitely, perhaps forever.

Excellent post, 10of Rods.

Lots to ponder. I agree with all your points. Until we have a reliable vaccine, many of us in potentially high-risk groups will be doing some sort of social isolation for months. I am also going to mentally prepare to continue with social isolation through into 2021. I'm kind of a hermit, anyway.

Fortunately, I have a job to go to, even though our hours have been radically changed, but I find I need the mental challenge and the limited personal interaction my job gives me.

And I also share your concerns about future travel.

All this has really upended my retirement plans (most especially the finances !!)

 

[155etta]

Where would I find such a wonder as a shop towel? I can't even find regular paper towels.

Walmart, in the automotive section. Harbor Freight. Parts stores.

 

[margarita25]

@dotr, I see you :waves:

Did you see that article about ocean water? It’s upstream...I think you may find it of interest, based on some early previous discussions.

I’m not sure what I think about it but I definitely think it may need some review/clarification ... there are some potential implications to look at IF this is true moo:

Coronavirus at beaches? Surfers, swimmers should stay away, scientist says

“Kim Prather, a leading atmospheric chemist at the Scripps Institution of Oceanography, wants to yell out her window at every surfer, runner, and biker she spots along the San Diego coast.

“I wouldn’t go in the water if you paid me $1 million right now,” she said.”

[...]

“Prather fears that SARS-CoV-2, the virus that causes COVID-19, could enter coastal waters in similar ways and transfer back into the air along the coast.

In her research, Prather has found that the ocean churns up all kinds of particulate and microscopic pathogens, and every time the ocean sneezes with a big wave or two, it sprays these particles into the air. She believes that this new coronavirus is light enough to float through the air much farther than we think. The six-feet physical distancing rule, she said, doesn’t apply at the beach, where coastal winds can get quite strong and send viral particles soaring.”